-
PurposeLocalization of mGreenLantern fluorescent protein to tubulin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnspecified
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGreenLantern
-
SpeciesH. sapiens (human)
-
Insert Size (bp)717
-
MutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L221K/F223R/G232D
- Promoter CMV
-
Tag
/ Fusion Protein
- Tubulin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BshTI (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer GACATGGACGAGCTGTACAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tubulin-mGreenLantern was a gift from Gregory Petsko (Addgene plasmid # 164460 ; http://n2t.net/addgene:164460 ; RRID:Addgene_164460) -
For your References section:
mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging. Campbell BC, Nabel EM, Murdock MH, Lao-Peregrin C, Tsoulfas P, Blackmore MG, Lee FS, Liston C, Morishita H, Petsko GA. Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18. 10.1073/pnas.2000942117 PubMed 33208539