AdTrack-HNF4
(Plasmid
#16445)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 16445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAdTrack-CMV
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression, Adenoviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHNF4
-
Alt nameHNF-4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1400
-
Entrez GeneHnf4a (a.k.a. HNF-4, Hnf4, Hnf4alpha, MODY1, Nr2a1, TCF-14, Tcf14)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' PCR primer: TTAAGGTACCACCATGGATATGGCCGACTACA GCGCTGCCC. 3' PCR primer: TTAAAAGCTTCTAGATGGCTTCTTGCTTGGTG ATCGTTGGC. Full sequence is approximated based on primers and predicted AdTrack sequence.
Recombine with pAdEasy to create adenovirus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AdTrack-HNF4 was a gift from Bruce Spiegelman (Addgene plasmid # 16445) -
For your References section:
Partnership of PGC-1alpha and HNF4alpha in the regulation of lipoprotein metabolism. Rhee J, Ge H, Yang W, Fan M, Handschin C, Cooper M, Lin J, Li C, Spiegelman BM. J Biol Chem. 2006 May 26. 281(21):14683-90. 10.1074/jbc.M512636200 PubMed 16574644