Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-hRedOpsin-TGFB2
(Plasmid #164428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Backbone size w/o insert (bp) 6062
  • Total vector size (bp) 7316
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tgfb2
  • Alt name
    transforming growth factor beta 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1254
  • Entrez Gene
    Tgfb2 (a.k.a. Tgf-beta2, Tgfb-2)
  • Promoter human red opsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer gccatcccgcccactttcta
  • 3′ sequencing primer tccgctggattgagggccgaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hRedOpsin-TGFB2 was a gift from Connie Cepko (Addgene plasmid # 164428 ; http://n2t.net/addgene:164428 ; RRID:Addgene_164428)
  • For your References section:

    Microglia modulation by TGF-beta1 protects cones in mouse models of retinal degeneration. Wang SK, Xue Y, Cepko CL. J Clin Invest. 2020 Aug 3;130(8):4360-4369. doi: 10.1172/JCI136160. 10.1172/JCI136160 PubMed 32352930