AAV-hRedOpsin-TGFB1
(Plasmid
#164427)
-
PurposeAAV plasmid expressing TGFB1 in photoreceptors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-MCS8
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Backbone size w/o insert (bp) 6062
- Total vector size (bp) 7244
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTgfb1
-
Alt nametransforming growth factor beta 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1182
-
Entrez GeneTgfb1 (a.k.a. TGF-beta1, TGFbeta1, Tgfb, Tgfb-1)
- Promoter human red opsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer gtggccagatcctgtccaaa
- 3′ sequencing primer tccgctggattgagggccgaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hRedOpsin-TGFB1 was a gift from Connie Cepko (Addgene plasmid # 164427 ; http://n2t.net/addgene:164427 ; RRID:Addgene_164427) -
For your References section:
Microglia modulation by TGF-beta1 protects cones in mouse models of retinal degeneration. Wang SK, Xue Y, Cepko CL. J Clin Invest. 2020 Aug 3;130(8):4360-4369. doi: 10.1172/JCI136160. 10.1172/JCI136160 PubMed 32352930