Skip to main content
Addgene

AAV-hRedOpsin-fCD200
(Plasmid #164425)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164425 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Backbone size w/o insert (bp) 6062
  • Total vector size (bp) 854
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD200
  • Alt name
    Cluster of Differentiation 200
  • Alt name
    OX-2 membrane glycoprotein
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cd200 (a.k.a. Mox, Mox2, OX, OX2)
  • Promoter human red opsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer gttgtaatccagcctgccta
  • 3′ sequencing primer gtcccagtacccttccagga
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hRedOpsin-fCD200 was a gift from Connie Cepko (Addgene plasmid # 164425 ; http://n2t.net/addgene:164425 ; RRID:Addgene_164425)

  • For your References section:

    Soluble CX3CL1 gene therapy improves cone survival and function in mouse models of retinitis pigmentosa. Wang SK, Xue Y, Rana P, Hong CM, Cepko CL. Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29. 10.1073/pnas.1901787116 PubMed 31036641
Related items:
Commonly requested with: