pHSG1C3
(Plasmid #164423)

• Purpose: single guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.
• Depositing Lab: Xiao Wang
• Publication: Standage-Beier et al ACS Synth Biol. 2021 Feb 19;10(2):422-427. doi: 10.1021/acssynbio.0c00445. Epub 2021 Jan 19.

Backbone

• Vector backbone: Derived from pSB1C3
• Backbone manufacturer: Registry of Standard Biological Parts
• Total vector size (bp): 2481
• Modifications to backbone: U6 promoter, sgRNA scaffold and restriction cloning sites.
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA
• Alt name: single guide RNA
• gRNA/shRNA sequence: Non-targeted guide, BbsI restriction sites.
• Species: Synthetic
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (unknown if destroyed)
• 3′ cloning site: BbsI or PstI (unknown if destroyed)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: AATACCGCCTTTGAGTGAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry