Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-Best1-sCX3CL1
(Plasmid #164422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164422 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV-MCS8
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Backbone size w/o insert (bp) 4768
  • Total vector size (bp) 5796
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cx3cl1
  • Alt name
    fractalkine
  • Alt name
    neurotactin
  • Alt name
    C-X3-C Motif Chemokine Ligand 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1028
  • Mutation
    deleted terminal 59 amino acids
  • Entrez Gene
    Cx3cl1 (a.k.a. AB030188, ABCD-3, AI848747, CX3C, Cxc3, D8Bwg0439e, Scyd, Scyd1, fract, neuro)
  • Promoter Best1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gatctagctcctgggctgag
  • 3′ sequencing primer gctcttgggaagtccccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Best1-sCX3CL1 was a gift from Connie Cepko (Addgene plasmid # 164422 ; http://n2t.net/addgene:164422 ; RRID:Addgene_164422)
  • For your References section:

    Soluble CX3CL1 gene therapy improves cone survival and function in mouse models of retinitis pigmentosa. Wang SK, Xue Y, Rana P, Hong CM, Cepko CL. Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29. 10.1073/pnas.1901787116 PubMed 31036641