AAV-hRedOpsin-fCX3CL1
(Plasmid
#164421)
-
PurposeAAV plasmid expressing full-length CX3CL1 (fractalkine) in photoreceptors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164421 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV-MCS8
-
Backbone manufacturerJeng-Shin Lee, Harvard University
- Backbone size w/o insert (bp) 6062
- Total vector size (bp) 7267
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCx3cl1
-
Alt namefractalkine
-
Alt nameneurotactin
-
Alt nameC-X3-C Motif Chemokine Ligand 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1205
-
Entrez GeneCx3cl1 (a.k.a. AB030188, ABCD-3, AI848747, CX3C, Cxc3, D8Bwg0439e, Scyd, Scyd1, fract, neuro)
- Promoter human red opsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer gatctagctcctgggctgag
- 3′ sequencing primer gctcttgggaagtccccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hRedOpsin-fCX3CL1 was a gift from Connie Cepko (Addgene plasmid # 164421 ; http://n2t.net/addgene:164421 ; RRID:Addgene_164421) -
For your References section:
Soluble CX3CL1 gene therapy improves cone survival and function in mouse models of retinitis pigmentosa. Wang SK, Xue Y, Rana P, Hong CM, Cepko CL. Proc Natl Acad Sci U S A. 2019 May 14;116(20):10140-10149. doi: 10.1073/pnas.1901787116. Epub 2019 Apr 29. 10.1073/pnas.1901787116 PubMed 31036641