pEF-XMAS-2xStop
(Plasmid #164412)

• Purpose: Transient Reporter for Editing Enrichment (TREE) Plasmid. GFP turns on with adenosine base editing (ABE). 2 stop codons.
• Depositing Lab: Xiao Wang
• Publication: Brookhouser et al BMC Biol. 2020 Dec 14;18(1):193. doi: 10.1186/s12915-020-00929-7.

Backbone

• Vector backbone: Backbone derived from pEF-GFP (Addgene #11154)
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Alt name: RFP
• Promoter: EF1-alpha
• Tag / Fusion Protein:
  • T2A-GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: TAGTCGCCGTGAACGTTCTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry