pJJF496_dpy-10_CDS_sg6
(Plasmid
#164267)
-
PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJJR50 (Waaijers et al. 2016)
-
Backbone manufacturerAddgene Plasmid #75026
- Backbone size w/o insert (bp) 3425
- Total vector size (bp) 3422
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting the coding sequence of dpy-10
-
gRNA/shRNA sequenceGCTCGTGGTGCCTATGGTAG(NGG)
-
SpeciesSynthetic
- Promoter R07E5.16 (U6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (aka BpiI) (destroyed during cloning)
- 3′ cloning site BbsI (aka BpiI) (destroyed during cloning)
- 5′ sequencing primer M13-24F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJJF496_dpy-10_CDS_sg6 was a gift from Nikolaus Rajewsky (Addgene plasmid # 164267 ; http://n2t.net/addgene:164267 ; RRID:Addgene_164267) -
For your References section:
Parallel genetics of regulatory sequences using scalable genome editing in vivo. Froehlich JJ, Uyar B, Herzog M, Theil K, Glazar P, Akalin A, Rajewsky N. Cell Rep. 2021 Apr 13;35(2):108988. doi: 10.1016/j.celrep.2021.108988. 10.1016/j.celrep.2021.108988 PubMed 33852857