Skip to main content
Addgene

pXPR_070
(Plasmid #164265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164265 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXPR_053
  • Backbone manufacturer
    Arlene Sharpe's Lab
  • Backbone size w/o insert (bp) 7670
  • Total vector size (bp) 8050
  • Modifications to backbone
    (1) Removal of LacO sequence from U6 promoter. (2) Introduction of a stuffer into the stem loop of the Broad GPP chRNA V2. The stuffer contains transcriptional stops on the proximal 5’ and 3’ ends. This stuffer is flanked by loxP sequences that are in the same directional orientation.
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, CRISPR
  • Selectable markers
    Vex fluorescent reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA cassette
  • gRNA/shRNA sequence
    NA
  • Promoter Human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_070 was a gift from Arlene Sharpe (Addgene plasmid # 164265 ; http://n2t.net/addgene:164265 ; RRID:Addgene_164265)
  • For your References section:

    X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. LaFleur MW, Lemmen AM, Streeter ISL, Nguyen TH, Milling LE, Derosia NM, Hoffman ZM, Gillis JE, Tjokrosurjo Q, Markson SC, Huang AY, Anekal PV, Montero Llopis P, Haining WN, Doench JG, Sharpe AH. Nat Immunol. 2023 Nov 27. doi: 10.1038/s41590-023-01689-6. 10.1038/s41590-023-01689-6 PubMed 38012416