pMTP170 (pBAD33_CRISPR(Tn6900)-entry)
(Plasmid #164263)

• Purpose: (Empty Backbone) Entry vector for cloning user-defined spacers in the Tn6900 CRISPR array.
• Depositing Lab: Joseph Peters
• Publication: Petassi et al Cell. 2020 Nov 30. pii: S0092-8674(20)31464-1. doi: 10.1016/j.cell.2020.11.005.

Backbone

• Vector backbone: pBAD33
• Backbone size (bp): 5352
• Modifications to backbone: Removed additional BsaI site downstream of MCS with a single base substitution to accommodate cloning method. Original sequence = gagccggtgagcgtgggtctcgcggtatc. New sequence = gagccggtgagcgtgggactcgcggtatc.
• Vector type: Bacterial Expression
• Promoter: Arabinose

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTAACAAAGCGGGACCAAAG

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reference for vector backbone.
Guzman, L. M., Belin, D., Carson, M. J., & Beckwith, J. (1995). Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Journal of Bacteriology, 177(14), 4121–4130.