pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
(Plasmid #164262)

• Purpose: Vector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.
• Depositing Lab: Joseph Peters
• Publication: Petassi et al Cell. 2020 Nov 30. pii: S0092-8674(20)31464-1. doi: 10.1016/j.cell.2020.11.005.

Backbone

• Vector backbone: pBAD322G
• Backbone size w/o insert (bp): 4357
• Total vector size (bp): 9320
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Codon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
• Species: Aeromonas salmonicida
• Insert Size (bp): 5006
• GenBank ID: NZ_CP022176.1 DQ119284.1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTAACAAAGCGGGACCAAAG

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reference for vector backbone.
Cronan, J. E. (2006). A family of arabinose-inducible Escherichia coli expression vectors having pBR322 copy control. Plasmid, 55(2), 152–157. http://doi.org/10.1016/j.plasmid.2005.07.001