pHP138 Myc-TRF2-deltaB deltaM
(Plasmid #164255)

• Purpose: for generation of mammalian cells with inducible expression of dominant negative TRF2 for induction of telomere crisis used together with any PiggyBac transposase plasmid
• Depositing Lab: John Maciejowski
• Publication: Mohr et al Mol Cell. 2021 Jan 12. pii: S1097-2765(20)30958-8. doi: 10.1016/j.molcel.2020.12.037.

Backbone

• Vector backbone: pHP138
• Backbone size w/o insert (bp): 7897
• Total vector size (bp): 9124
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRF2
• Species: H. sapiens (human)
• Insert Size (bp): 1200
• Mutation: deletion of amino acids-86 and 496-542
• GenBank ID: NM_005652.4
• Promoter: Tetracycline inducible promotor
• Tag / Fusion Protein:
  • Myc (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctcgtttagtgaaccgtcagat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry