pU6-TREX1 g3 Cas9-T2A-mCherry
(Plasmid
#164252)
-
PurposeTranscription of TREX1 guide RNA and Cas9 expression for CRISPR/Cas9 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepU6 Cas9-T2A-mCherry
- Backbone size w/o insert (bp) 9265
- Total vector size (bp) 9284
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTREX1
-
gRNA/shRNA sequenceCCTCATCTTTTTCGACATGG
-
Insert Size (bp)19
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-TREX1 g3 Cas9-T2A-mCherry was a gift from John Maciejowski (Addgene plasmid # 164252 ; http://n2t.net/addgene:164252 ; RRID:Addgene_164252) -
For your References section:
ER-directed TREX1 limits cGAS activation at micronuclei. Mohr L, Toufektchan E, von Morgen P, Chu K, Kapoor A, Maciejowski J. Mol Cell. 2021 Jan 12. pii: S1097-2765(20)30958-8. doi: 10.1016/j.molcel.2020.12.037. 10.1016/j.molcel.2020.12.037 PubMed 33476576