pSC201plus
(Plasmid #164227)

• Purpose: (Empty Backbone) Integrative plasmid to introduce modified rhamnose-inducible promoter into bacterial genomes. Harbours enhanced rhaS binding site and encodes T7 gene10 stem loop in mRNA for enhanced expression
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al Appl Environ Microbiol. 2021 Jun 30:AEM0064721. doi: 10.1128/AEM.00647-21.

Backbone

• Vector backbone: pSC201
• Backbone manufacturer: Miguel Valvano and Silvia Cardona
• Backbone size (bp): 5461
• Modifications to backbone: Upstream of PrhaBAD, exchanged rhaI2 site for rhaI1 (resulting in two rhaI1 sites). Downstream of PrhaBAD, added T7 gene 10 stem loop as 5' extension of mRNA.
• Vector type: Bacterial Expression, Synthetic Biology
• Promoter: Rhamnose-inducible

Growth in Bacteria

• Bacterial Resistance(s): Trimethoprim
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: GTTCTATCGCCACGGACG
• 3′ sequencing primer: AACAAGCCAGGGATGTAACG

Resource Information

• Supplemental Documents:
  • pSC201plus.gb
• A portion of this plasmid was derived from a plasmid made by: Flannagan et al. (2007) from University of Western Ontario. The oriR6K and oriT were cloned from pGPΩTp (Addgene plasmid #130660).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is derived from pSC201, which itself was made by cloning oriR6K and oriT from pGPΩTp (available on Addgene as plasmid #130660). pGPΩTp constructed by Flannagan et al. (2007). Originally from University of Western Ontario.