Skip to main content
Addgene

pAAV Syn CaMPARI2-human-a-Tubulin (TubuTag)
(Plasmid #164184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164184 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 7275
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CamPARI2
  • Species
    Synthetic
  • Insert Size (bp)
    1306
  • Promoter Syn
  • Tags / Fusion Proteins
    • NES (N terminal on insert)
    • 6 His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bsp1407I (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer CTTGTACATTGAGCTCAGCCGACCTATAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Human α Tubulin
  • Alt name
    h a Tubulin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1353
  • Promoter Syn

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ctattttaagcagtcgtttc
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CaMPARI2 was a kind gift from Eric Schreiter, Janelia farm USA Marina Mikhaylove Lab provided us kindly with the Human α Tubulin

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Syn CaMPARI2-human-a-Tubulin (TubuTag) was a gift from Thomas Oertner (Addgene plasmid # 164184 ; http://n2t.net/addgene:164184 ; RRID:Addgene_164184)
  • For your References section:

    Freeze-Frame Imaging of Dendritic Calcium Signals With TubuTag. Perez-Alvarez A, Huhn F, Durst CD, Franzelin A, Lamothe-Molina PJ, Oertner TG. Front Mol Neurosci. 2021 Mar 4;14:635820. doi: 10.3389/fnmol.2021.635820. eCollection 2021. 10.3389/fnmol.2021.635820 PubMed 33762909