-
Purpose(Empty Backbone) Retroviral expression vector with hygromycin resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMXS-IRES-hygro
- Backbone size (bp) 5600
-
Modifications to backbonepMXS-IRES-blast modified by replacing blast resistance with hygromycin resistance cassette
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer GGCGGAATTTACGTAGCGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-Hygro was a gift from Richard Possemato (Addgene plasmid # 164142 ; http://n2t.net/addgene:164142 ; RRID:Addgene_164142)
