pAAV-Tetoffbidir -Alb-luc
(Plasmid #164078)

• Purpose: AAV vector with bidirectional promoter controls expression firefly Luciferase with TRE and Tet-off transactivator
• Depositing Lab: Shu Uin Gan
• Publication: Gan et al J Gene Med. 2019 Jan;21(1):e3067. doi: 10.1002/jgm.3067. Epub 2019 Jan 20.

Backbone

• Vector backbone: pAAV‐Tetbidir‐Alb‐luc
• Backbone manufacturer: Dr Gloria Gonzalez‐Aseguinolaza
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7660
• Modifications to backbone: Convert tet-on to tet-off
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Firefly Luciferase
• Species: Firefly
• Insert Size (bp): 1653
• Promoter: Albumin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catacgcaagggatttagtcaaac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: already present in the vector obtained from Dr Gloria Gonzalez‐Aseguinolaza. We modified from the vector from Tet-On to Tet-Off.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS analysis identified a few sequence discrepancies in the plasmid backbone. The depositing laboratory has confirmed that these should not impact function.