Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Tetoffbidir -Alb-luc
(Plasmid #164078)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV‐Tetbidir‐Alb‐luc
  • Backbone manufacturer
    Dr Gloria Gonzalez‐Aseguinolaza
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7660
  • Modifications to backbone
    Convert tet-on to tet-off
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1653
  • Promoter Albumin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catacgcaagggatttagtcaaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    already present in the vector obtained from Dr Gloria Gonzalez‐Aseguinolaza. We modified from the vector from Tet-On to Tet-Off.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC NGS analysis identified a few sequence discrepancies in the plasmid backbone. The depositing laboratory has confirmed that these should not impact function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Tetoffbidir -Alb-luc was a gift from Shu Uin Gan (Addgene plasmid # 164078 ; http://n2t.net/addgene:164078 ; RRID:Addgene_164078)
  • For your References section:

    Development of a liver-specific Tet-off AAV8 vector for improved safety of insulin gene therapy for diabetes. Gan SU, Fu Z, Sia KC, Kon OL, Calne R, Lee KO. J Gene Med. 2019 Jan;21(1):e3067. doi: 10.1002/jgm.3067. Epub 2019 Jan 20. 10.1002/jgm.3067 PubMed 30592790