Skip to main content
Addgene

human KANK2 Ankyrin Repeats pET151
(Plasmid #164054)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164054 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5760
  • Total vector size (bp) 6510
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kidney Ankyrin Repeat-Containing Protein 2
  • Alt name
    KANK 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    750
  • Entrez Gene
    KANK2 (a.k.a. ANKRD25, MXRA3, NPHS16, PPKWH, SIP)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human KANK2 Ankyrin Repeats pET151 was a gift from Ben Goult (Addgene plasmid # 164054 ; http://n2t.net/addgene:164054 ; RRID:Addgene_164054)