PHY55-mouse U6-sgLMNA
(Plasmid
#164045)
-
PurposeU6-driven sgRNA targeting LMNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMNA targeting sgRNA
-
gRNA/shRNA sequenceGCCATGGAGACCCCGTCCCAG
-
SpeciesH. sapiens (human), Synthetic
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PHY55-mouse U6-sgLMNA was a gift from Baohui Chen (Addgene plasmid # 164045 ; http://n2t.net/addgene:164045 ; RRID:Addgene_164045) -
For your References section:
TriTag: an integrative tool to correlate chromatin dynamics and gene expression in living cells. Xu H, Wang J, Liang Y, Fu Y, Li S, Huang J, Xu H, Zou W, Chen B. Nucleic Acids Res. 2020 Oct 26. pii: 5940501. doi: 10.1093/nar/gkaa906. 10.1093/nar/gkaa906 PubMed 33104788