Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-PhoCl1-6His
(Plasmid #164033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-28a(+)
  • Backbone size w/o insert (bp) 5248
  • Total vector size (bp) 5974
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PhoCl1
  • Species
    Synthetic
  • Insert Size (bp)
    726
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • 6xHis Tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ggaattgtgagcggataacaattcc
  • 3′ sequencing primer ccgctgagcaataactagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PhoCl1-6His was a gift from Robert Campbell (Addgene plasmid # 164033 ; http://n2t.net/addgene:164033 ; RRID:Addgene_164033)
  • For your References section:

    Photocleavable proteins that undergo fast and efficient dissociation. Lu X, Wen Y, Zhang S, Zhang W, Chen Y, Shen Y, Lemieux MJ, Campbell RE. Chem Sci. 2021 May 31;12(28):9658-9672. doi: 10.1039/d1sc01059j. eCollection 2021 Jul 21. 10.1039/d1sc01059j PubMed 34349937