Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Human a3 nicotinic receptor subunit EM construct
(Plasmid #163960)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEZT-BM
  • Backbone manufacturer
    Hibbs Lab
  • Total vector size (bp) 8657
  • Vector type
    Mammalian Expression ; Baculovirus (bacmam) production and mammalian expression
  • Selectable markers
    mEGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human alpha3 nicotinic acetylcholine receptor subunit EM construct
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1671
  • Mutation
    Asn348-Ser402 replaced with apocytochrome b(562)RIL (BRIL)
  • Promoter CMV
  • Tag / Fusion Protein
    • apocytochrome b(562)RIL (BRIL)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ttgcctttctctccacaggt
  • 3′ sequencing primer gccatacgggaagcaatagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human a3 nicotinic receptor subunit EM construct was a gift from Ryan Hibbs (Addgene plasmid # 163960 ; http://n2t.net/addgene:163960 ; RRID:Addgene_163960)
  • For your References section:

    Agonist Selectivity and Ion Permeation in the alpha3beta4 Ganglionic Nicotinic Receptor. Gharpure A, Teng J, Zhuang Y, Noviello CM, Walsh RM Jr, Cabuco R, Howard RJ, Zaveri NT, Lindahl E, Hibbs RE. Neuron. 2019 Nov 6;104(3):501-511.e6. doi: 10.1016/j.neuron.2019.07.030. Epub 2019 Sep 2. 10.1016/j.neuron.2019.07.030 PubMed 31488329