-
PurposeExpresses uvsY for bacterial expression and affinity purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5653
-
Modifications to backboneRemove C terminal His tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameuvsY
-
SpeciesEnterobacteria phage T4
-
Insert Size (bp)411
-
Entrez GeneuvsY (a.k.a. T4p187, fdsB)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-MH6-uvsY was a gift from Paul Freemont (Addgene plasmid # 163914 ; http://n2t.net/addgene:163914 ; RRID:Addgene_163914) -
For your References section:
A Multiplexed Cas13-Based Assay with Point-of-Care Attributes for Simultaneous COVID-19 Diagnosis and Variant Surveillance. Patchsung M, Homchan A, Aphicho K, Suraritdechachai S, Wanitchanon T, Pattama A, Sappakhaw K, Meesawat P, Wongsatit T, Athipanyasilp A, Jantarug K, Athipanyasilp N, Buahom J, Visanpattanasin S, Niljianskul N, Chaiyen P, Tinikul R, Wichukchinda N, Mahasirimongkol S, Sirijatuphat R, Angkasekwinai N, Crone MA, Freemont PS, Joung J, Ladha A, Abudayyeh O, Gootenberg J, Zhang F, Chewapreecha C, Chanarat S, Horthongkham N, Pakotiprapha D, Uttamapinant C. CRISPR J. 2022 Nov 11. doi: 10.1089/crispr.2022.0048. 10.1089/crispr.2022.0048 PubMed 36367987