Skip to main content
Addgene

pET28a-gp32-H6
(Plasmid #163912)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163912 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 6121
  • Modifications to backbone
    Remove N terminal His tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gp32
  • Species
    Enterobacteria phage T4
  • Insert Size (bp)
    903
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-gp32-H6 was a gift from Paul Freemont (Addgene plasmid # 163912 ; http://n2t.net/addgene:163912 ; RRID:Addgene_163912)

  • For your References section:

    A Multiplexed Cas13-Based Assay with Point-of-Care Attributes for Simultaneous COVID-19 Diagnosis and Variant Surveillance. Patchsung M, Homchan A, Aphicho K, Suraritdechachai S, Wanitchanon T, Pattama A, Sappakhaw K, Meesawat P, Wongsatit T, Athipanyasilp A, Jantarug K, Athipanyasilp N, Buahom J, Visanpattanasin S, Niljianskul N, Chaiyen P, Tinikul R, Wichukchinda N, Mahasirimongkol S, Sirijatuphat R, Angkasekwinai N, Crone MA, Freemont PS, Joung J, Ladha A, Abudayyeh O, Gootenberg J, Zhang F, Chewapreecha C, Chanarat S, Horthongkham N, Pakotiprapha D, Uttamapinant C. CRISPR J. 2022 Nov 11. doi: 10.1089/crispr.2022.0048. 10.1089/crispr.2022.0048 PubMed 36367987
Related items:
Commonly requested with: