KIF13B
(Plasmid
#163907)
-
PurposeFull length mouse KIF13B for purification from insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac HTa
-
Backbone manufacturerthermo fisher (Invitrogen)
- Backbone size w/o insert (bp) 4812
- Total vector size (bp) 10344
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namekif13b
-
Alt nameGAKIN
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5532
-
Entrez GeneKif13b (a.k.a. 5330429L19Rik, 6030414C01, C130021D12Rik, GAKIN)
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- Cleavable 6 x HIS tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nar1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe codon optimized DNA was synthesized by a company (BaseClear)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KIF13B was a gift from Martin Loose (Addgene plasmid # 163907 ; http://n2t.net/addgene:163907 ; RRID:Addgene_163907) -
For your References section:
In vitro reconstitution reveals phosphoinositides as cargo-release factors and activators of the ARF6 GAP ADAP1. Duellberg C, Auer A, Canigova N, Loibl K, Loose M. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2010054118. doi: 10.1073/pnas.2010054118. Epub 2020 Dec 18. 10.1073/pnas.2010054118 PubMed 33443153