ADAP1
(Plasmid #163905)

• Purpose: Full length mouse ADAP1 for purification from insect cells
• Depositing Lab: Martin Loose
• Publication: Duellberg et al Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2010054118. doi: 10.1073/pnas.2010054118. Epub 2020 Dec 18.

Backbone

• Vector backbone: pFastBac HTb
• Backbone manufacturer: thermo fisher (Invitrogen)
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 5920
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ADAP1
• Alt name: Centaurin alpha 1
• Species: M. musculus (mouse)
• Insert Size (bp): 1122
• Entrez Gene: Adap1 (a.k.a. 4930431P11Rik, Cent, Centa1, GC1L, p42IP4)
• Promoter: polyhedrin
• Tag / Fusion Protein:
  • Cleavable 6 x HIS tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NOT1 (not destroyed)
• 3′ cloning site: NCO1 (not destroyed)
• 5′ sequencing primer: AAATGATAACCATCTCGC
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Supplemental Documents:
  • ADAP1_Annotiert.ape.ape
• A portion of this plasmid was derived from a plasmid made by: The codon optimized DNA was synthesized by a company (genscript)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry