Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJJF449_dpy-10_CDS_sg1
(Plasmid #163866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163866 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJJR50 (Waaijers et al. 2016)
  • Backbone manufacturer
    Addgene Plasmid #75026
  • Backbone size w/o insert (bp) 3425
  • Total vector size (bp) 3422
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA targeting the coding sequence of dpy-10
  • gRNA/shRNA sequence
    GCTACCATAGGCACCACGAG(NGG)
  • Species
    Synthetic
  • Promoter R07E5.16 (U6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (aka BpiI) (destroyed during cloning)
  • 3′ cloning site BbsI (aka BpiI) (destroyed during cloning)
  • 5′ sequencing primer M13-24F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJJF449_dpy-10_CDS_sg1 was a gift from Nikolaus Rajewsky (Addgene plasmid # 163866 ; http://n2t.net/addgene:163866 ; RRID:Addgene_163866)
  • For your References section:

    Parallel genetics of regulatory sequences using scalable genome editing in vivo. Froehlich JJ, Uyar B, Herzog M, Theil K, Glazar P, Akalin A, Rajewsky N. Cell Rep. 2021 Apr 13;35(2):108988. doi: 10.1016/j.celrep.2021.108988. 10.1016/j.celrep.2021.108988 PubMed 33852857