Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

COG4 shRNA
(Plasmid #163861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    D. Root (Addgene #10878)
  • Backbone size w/o insert (bp) 7026
  • Total vector size (bp) 7084
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    component of oligomeric golgi complex 4
  • Alt name
    COG4
  • gRNA/shRNA sequence
    AAAGCAGCTGGCTGGAATGAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_015386
  • Entrez Gene
    COG4 (a.k.a. CDG2J, COD1, SWILS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    COG4 shRNA was a gift from Lei Lu (Addgene plasmid # 163861 ; http://n2t.net/addgene:163861 ; RRID:Addgene_163861)
  • For your References section:

    A quantitative study of the Golgi retention of glycosyltransferases. Sun X, Mahajan D, Chen B, Song Z, Lu L. J Cell Sci. 2021 Oct 15;134(20). pii: 272560. doi: 10.1242/jcs.258564. Epub 2021 Oct 21. 10.1242/jcs.258564 PubMed 34533190