pAC8_PH-6His-Nter-GWs-Lox (VE5587)
(Plasmid #163768)

• Purpose: Transfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.
• Depositing Lab: Arnaud Poterszman
• Publication: Kolesnikova et al Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5.

Backbone

• Vector backbone: pBAcPAK8
• Backbone manufacturer: Clontech
• Modifications to backbone: The pAC8_PH-6His-Nter-GWs-Lox (VE5587) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains an expression cassette composed of one baculovirus late promoter (PH). This vector bears a 6 His sequence allowing the expression of a N-terminally-tagged protein under the control of the pH promoter. Insertion of DNA sequence is typically performed by Gateway® LR reaction.
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-terminal 6His tag
• Promoter: PH
• Tag / Fusion Protein:
  • 6 His Tag (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ACCATCTCGCAAATAAATAA

Resource Information

• Supplemental Documents:
  • pAC8_PH-6His-Nter-GWs-Lox (VE5587).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry