pYX233
(Plasmid
#163762)
-
Purpose(Empty Backbone) Empty vector for Gal-inducible yeast expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepYX233
- Backbone size (bp) 7400
-
Vector typeYeast Expression
- Promoter GAL1
-
Selectable markersTRP1
-
Tag
/ Fusion Protein
- Hemagglutinin (HA) tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ATATACCTCTATACTTTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYX233 was a gift from Johannes Herrmann (Addgene plasmid # 163762 ; http://n2t.net/addgene:163762 ; RRID:Addgene_163762) -
For your References section:
Mitochondrial protein-induced stress triggers a global adaptive transcriptional programme. Boos F, Kramer L, Groh C, Jung F, Haberkant P, Stein F, Wollweber F, Gackstatter A, Zoller E, van der Laan M, Savitski MM, Benes V, Herrmann JM. Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18. 10.1038/s41556-019-0294-5 PubMed 30886345
