Skip to main content
Addgene

gRNA_SRR134.3_miRFP670
(Plasmid #163754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163754 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    gRNA_CloningVector_miRFP670
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 5298
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA_SRR134.3
  • gRNA/shRNA sequence
    GAAGGATGAGGACGAATAGT
  • Species
    H. sapiens (human)
  • Promoter U6
  • Tag / Fusion Protein
    • miRFP670 (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA_CloningVector_miRFP670 (Addgene Plasmid #163748) was modified to insert the target sequence downstream of the SRR134 SOX2 enhancer (GAAGGATGAGGACGAATAGT). Use this gRNA plasmid together with Addgene Plasmid #163753 to knock-out SRR124 and SRR134 enhancers from human cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA_SRR134.3_miRFP670 was a gift from Jennifer Mitchell (Addgene plasmid # 163754 ; http://n2t.net/addgene:163754 ; RRID:Addgene_163754)
  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673