TET-pLKO-neo NXPH4-sh1
(Plasmid
#163744)
-
PurposeLentivirus for inducible knockdown of NXPH4 (human)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO-Tet-On (Tet-pLKO-Neo) Addgene # 21916
-
Backbone manufacturerWiederschain et al., 2009 Cell Cycle 8:3, 498-504
- Backbone size w/o insert (bp) 9084
- Total vector size (bp) 9143
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNXPH4
-
gRNA/shRNA sequenceCAAAGAGTCACGCGCTTTCAA
-
SpeciesH. sapiens (human)
-
Entrez GeneNXPH4 (a.k.a. NPH4)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TET-pLKO-neo NXPH4-sh1 was a gift from Roland Friedel (Addgene plasmid # 163744 ; http://n2t.net/addgene:163744 ; RRID:Addgene_163744)