Skip to main content
Addgene

TET-pLKO-neo CXCR4-sh1
(Plasmid #163741)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163741 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO-Tet-On (Tet-pLKO-Neo) Addgene # 21916
  • Backbone manufacturer
    Wiederschain et al., 2009 Cell Cycle 8:3, 498-504
  • Backbone size w/o insert (bp) 9084
  • Total vector size (bp) 9143
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CXCR4
  • gRNA/shRNA sequence
    CCGTGGCAAACTGGTACTTTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    CXCR4 (a.k.a. CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS, WHIMS1)
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene recommends screening 3-5 colonies immediately upon receipt, as this plasmid may be prone to recombination.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TET-pLKO-neo CXCR4-sh1 was a gift from Roland Friedel (Addgene plasmid # 163741 ; http://n2t.net/addgene:163741 ; RRID:Addgene_163741)