pAAV-CAG-GFP-mirMecp2
(Plasmid
#163704)
-
PurposepAAV plasmid to induce expression of micro-RNA targeted against mouse Mecp2 and EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemirMecp2 and EGFP
-
gRNA/shRNA sequenceTGCTGTTCACCTGAACACCTTCTGATGTTTTGGCCACTGACTGACATCAGAAGGTTCAGGTGAA
-
SpeciesM. musculus (mouse); Aequorea victoria
-
Entrez GeneMecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-GFP-mirMecp2 was a gift from Michisuke Yuzaki (Addgene plasmid # 163704 ; http://n2t.net/addgene:163704 ; RRID:Addgene_163704) -
For your References section:
MeCP2 Levels Regulate the 3D Structure of Heterochromatic Foci in Mouse Neurons. Ito-Ishida A, Baker SA, Sillitoe RV, Sun Y, Zhou J, Ono Y, Iwakiri J, Yuzaki M, Zoghbi HY. J Neurosci. 2020 Nov 4;40(45):8746-8766. doi: 10.1523/JNEUROSCI.1281-19.2020. Epub 2020 Oct 12. 10.1523/JNEUROSCI.1281-19.2020 PubMed 33046553