Skip to main content
Addgene

AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
(Plasmid #163701)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163701 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAVS1
  • Backbone size w/o insert (bp) 8691
  • Total vector size (bp) 10512
  • Modifications to backbone
    Inserted T2-sgRNA target sequence (23bp) into SspI cut site to induce plasmid linearized inside the cell.
  • Vector type
    Mammalian Expression, AAV, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SOX2-3xHA-P2A-tagBFP
  • Alt name
    ANOP3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1821
  • GenBank ID
    NM_003106
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • 3x-HA (C terminal on insert)
    • P2A-tagBFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rtTA
  • Species
    Synthetic
  • Insert Size (bp)
    853
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer CAGAGGGAAAAAGATCTCAGT
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    T2-sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    23

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SspI (destroyed during cloning)
  • 3′ cloning site SspI (destroyed during cloning)
  • 5′ sequencing primer agtggaggaagacggaacct
  • 3′ sequencing primer agcaaaaacaggaaggcaaa
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid backbone was modified from Addgene Plasmid #73497 to insert the SOX2-3xHA-P2A-tagBFP cassette. sgRNA T2 target sequence (ggggccactagggacaggattgg) was cloned from Addgene Plasmid #72833 into the SspI cutsite in order to induce plasmid linearization inside the cell. Use this construct together with Addgene Plasmid #72833 to induce AAVS1 HDR integration.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP was a gift from Jennifer Mitchell (Addgene plasmid # 163701 ; http://n2t.net/addgene:163701 ; RRID:Addgene_163701)

  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673
Related items: