Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRM14
(Plasmid #163693)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163693 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tol2
  • Backbone size w/o insert (bp) 7854
  • Total vector size (bp) 10029
  • Modifications to backbone
    mammalian DNA helicase B (DHB) amino acids 994-1087 fused to mNeonGreen co-expressed with H2B::mScarlet cloned between BamHI and ClaI sites
  • Vector type
    Unspecified ; Zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHB:mNeonGreen-P2A-H2B:mScarlet
  • Alt name
    DNA Helicase B (CDK sensor) (aa 994–1087) (HELB)
  • Alt name
    H2BC11
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_021058.4 NM_001370285.1
  • Entrez Gene
    HELB (a.k.a. DHB, hDHB)
  • Entrez Gene
    H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
  • Promoter HSP70
  • Tags / Fusion Proteins
    • mNeonGreen (C terminal on insert)
    • mScarlet (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

DNA Helicase B (DHB) as a CDK sensor described in:
Hahn, A.T., Jones, J.T., and Meyer, T. (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle 8, 1044-1052.

Spencer, S.L., Cappell, S.D., Tsai, F.C., Overton, K.W., Wang, C.L., and Meyer, T. (2013). The proliferation-quiescence decision is controlled by a bifurcation in CDK2 activity at mitotic exit. Cell 155, 369-383.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRM14 was a gift from David Matus (Addgene plasmid # 163693 ; http://n2t.net/addgene:163693 ; RRID:Addgene_163693)
  • For your References section:

    Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383