Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV hSynapsin flexed SV-tag
(Plasmid #163686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163686 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    synaptophysin 9X HA
  • Species
    M. musculus (mouse)
  • Promoter synapsin
  • Tag / Fusion Protein
    • 9X HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGAGATGCCTATGTGCCGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSynapsin flexed SV-tag was a gift from Bernardo Sabatini (Addgene plasmid # 163686 ; http://n2t.net/addgene:163686 ; RRID:Addgene_163686)
  • For your References section:

    Rapid purification and metabolomic profiling of synaptic vesicles from mammalian brain. Chantranupong L, Saulnier JL, Wang W, Jones DR, Pacold ME, Sabatini BL. Elife. 2020 Oct 12;9. pii: 59699. doi: 10.7554/eLife.59699. 10.7554/eLife.59699 PubMed 33043885