Skip to main content
Addgene

pAAV hSynapsin SV-tag
(Plasmid #163685)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163685 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    synatophysin 9X HA tag T2A tdtomato
  • Species
    M. musculus (mouse)
  • Promoter synapsin
  • Tag / Fusion Protein
    • 9X HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gggggcacgggcgcgaccatctg
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSynapsin SV-tag was a gift from Bernardo Sabatini (Addgene plasmid # 163685 ; http://n2t.net/addgene:163685 ; RRID:Addgene_163685)

  • For your References section:

    Rapid purification and metabolomic profiling of synaptic vesicles from mammalian brain. Chantranupong L, Saulnier JL, Wang W, Jones DR, Pacold ME, Sabatini BL. Elife. 2020 Oct 12;9. pii: 59699. doi: 10.7554/eLife.59699. 10.7554/eLife.59699 PubMed 33043885
Related items:
Commonly requested with: