Skip to main content
Addgene

pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
(Plasmid #163643)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163643 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lenti, 3rd generation
  • Backbone manufacturer
    Phil Sharp and Feng Zhang, Addgene Plasmid #63592
  • Backbone size w/o insert (bp) 8251
  • Total vector size (bp) 13228
  • Modifications to backbone
    Added a pU6-hgRNA expression cassette and pEFS-Luc2-P2A-tdTomato-T2A-human TdT
  • Vector type
    Lentiviral
  • Selectable markers
    tdTomato

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Cells can be grown at 37C, but growth at 30C is recommended for NEBStable.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pU6-CHYRON17 hgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    349
  • Mutation
    The SpCas9 sgRNA constant region is mutated to make it self-targeting.
  • Promoter pU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGTAAGACCACCGCACAGC
  • 3′ sequencing primer TGCTGTCCCTGTAATAAACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Luc2-P2A-tdTomato-T2A-human TdT
  • Alt name
    terminal deoxynucleotidyl transferase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4752
  • Entrez Gene
    DNTT (a.k.a. TDT)
  • Promoter EFS
  • Tag / Fusion Protein
    • Luc2-P2A-tdTomato-T2A (N terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAAGTGATGTCGTGTACTGG
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pU6 is from pSQT1313, Addgene Plasmid #53370, made by the Keith Joung lab. The Luc2-P2A-tdTomato sequence is from pCDH-EF1-Luc2-P2A-tdTomato, Addgene Plasmid #72486, made by the Kazuhiro Oka lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mutations that make the sgRNA scaffold self-targeting or homing are described in Perli et al., 2016, doi: 10.1126/science.aag0511 and Kalhor et al., 2017, doi: 10.1038/nmeth.4108.

This is a 3rd generation lentiviral transfer plasmid. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT was a gift from Chang Liu (Addgene plasmid # 163643 ; http://n2t.net/addgene:163643 ; RRID:Addgene_163643)
  • For your References section:

    Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928