pAWK61
(Plasmid #163642)

• Purpose: rps-27>DHB::GFP-P2A-H2B::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome I
• Depositing Lab: David Matus
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: pAP088
• Backbone manufacturer: Bob Goldstein/Ari Pani
• Backbone size w/o insert (bp): 11401
• Total vector size (bp): 15756
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DHB::GFP-P2A-H2B::2xmKate2::3xHA
• Alt name: DNA Helicase B (CDK sensor)
• Alt name: his-58 (H2B)
• Species: H. sapiens (human), C. elegans (nematode)
• Insert Size (bp): 3498
• Entrez Gene: his-58 (a.k.a. CELE_F54E12.4)
• Promoter: rps-27
• Tags / Fusion Proteins:
  • GFP (C terminal on insert)
  • 2xmKate2 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgtaaaacgacggccagt
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Resource Information

• Supplemental Documents:
  • pAWK61-rps-27-DHB-GFP-P2A-H2B-2xmKate2-3xHA.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GFP fusion of C. elegans codon-optimized DNA Helicase B (DHB) under the rps-27 promoter for ubiquitous expression, co-expressed with H2B::2xmKate2. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082

Please note: Plasmid contains a 117bp deletion in left homology arm relative to the depositor's provided sequence. This deletion is not known to affect plasmid function, but may slightly lower knock-in efficiency.