pWZ186
(Plasmid #163641)

• Purpose: rps-27>DHB::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome I
• Depositing Lab: David Matus
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: pAP088
• Backbone manufacturer: Bob Goldstein/Ari Pani
• Backbone size w/o insert (bp): 11926
• Total vector size (bp): 14454
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DHB:2xmKate2::3xHA
• Alt name: DNA Helicase B (CDK sensor) (aa 994–1087)
• Species: Synthetic
• Insert Size (bp): 2528
• Promoter: rps-27
• Tag / Fusion Protein:
  • 2xmKate2

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgtaaaacgacggccagt
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Resource Information

• Supplemental Documents:
  • pWZ186.ape
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2xmKate2 fusion of C. elegans codon-optimized DNA Helicase B (DHB) under the rps-27 promoter for ubiquitous expression. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082