pWZ157
(Plasmid #163639)

• Purpose: pcn-1>PCN-1::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome I
• Depositing Lab: David Matus
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: pAP088
• Backbone manufacturer: Bob Goldstein/Ari Pani
• Backbone size w/o insert (bp): 11077
• Total vector size (bp): 14480
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pcn-1
• Alt name: PCNA
• Species: C. elegans (nematode)
• Insert Size (bp): 3403
• Entrez Gene: pcn-1 (a.k.a. CELE_W03D2.4)
• Promoter: pcn-1
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgtaaaacgacggccagt
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Resource Information

• Supplemental Documents:
  • pWZ157_SEC_pcn-1-PCN-1-GFP-3xHA.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GFP fusion to C. elegans pcn-1 driven under its own endogenous promoter. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082