p10xQUAS-CsChrimson
(Plasmid #163629)

• Purpose: 10xQUAS effector expressing CsChrimson.mVenus for red-shifted optogenetic activation of neurons; Contains both P-element ends and attB integration sequence
• Depositing Lab: Christopher Potter
• Publication: Task et al Elife. 2022 Apr 20;11. pii: 72599. doi: 10.7554/eLife.72599.

Backbone

• Vector backbone: p10QUAS
• Backbone manufacturer: synthetic- Potter Lab
• Backbone size w/o insert (bp): 8335
• Total vector size (bp): 10676
• Modifications to backbone: includes P-element sites for P-element transposase insertion; also includes attB site for integration into attP genomic sites
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CsChrimson.mVenus
• Alt name: CsChrimson
• Species: Synthetic
• Insert Size (bp): 1875
• Tag / Fusion Protein:
  • mVenus (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCTTCGTCTACGGAGCGACAATTCAATTCAAAC

Resource Information

• Supplemental Documents:
  • p10xQUAS-CsChrimson-full.gb
• A portion of this plasmid was derived from a plasmid made by: PCR amplified from genomic DNA of UAS-CsChrimson flies.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2020.11.07.355651v2

Also refer to: Klapoetke, N.C., Murata, Y., Kim, S.S., Pulver, S.R., Birdsey-Benson, A., Cho, Y.K., Morimoto, T.K., Chuong, A.S., Carpenter, E.J., Tian, Z., et al. (2014). Independent optical excitation of distinct neural populations. Nat Methods 11, 338-346. PMID: 24509633, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943671/