Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-N1-mSNX27-H112A RNAi-resistant
(Plasmid #163621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse SNX27-H112A RNAi-resistant
  • Species
    M. musculus (mouse)
  • Mutation
    H112A and RNAi resistance
  • Entrez Gene
    Snx27 (a.k.a. 5730552M22Rik, D13Mgi2, ESTM4, ESTM45, ESTM47, R75405)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

fw primer RNAi resistant rat: GGGCAGCTGGAGAACCAAGTGATCGCATTCGAATGGGATGAGATGC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-mSNX27-H112A RNAi-resistant was a gift from Josef Kittler (Addgene plasmid # 163621 ; http://n2t.net/addgene:163621 ; RRID:Addgene_163621)
  • For your References section:

    SNX27-Mediated Recycling of Neuroligin-2 Regulates Inhibitory Signaling. Halff EF, Szulc BR, Lesept F, Kittler JT. Cell Rep. 2019 Nov 26;29(9):2599-2607.e6. doi: 10.1016/j.celrep.2019.10.096. 10.1016/j.celrep.2019.10.096 PubMed 31775031