Skip to main content
Addgene

phCMV-GALV-MTR
(Plasmid #163612)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163612 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    phCMV-ECO-ENV
  • Backbone manufacturer
    Addgene 15802
  • Backbone size w/o insert (bp) 4764
  • Total vector size (bp) 6825
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GaLV MTR envelope
  • Insert Size (bp)
    2061
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGGTCATCATCCTGCCTTT
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was generated by modification of Addgene plasmid 15802 to excise ENV-Eco and replace with ENV GALV-MTR.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phCMV-GALV-MTR was a gift from Daniel Hodson (Addgene plasmid # 163612 ; http://n2t.net/addgene:163612 ; RRID:Addgene_163612)

  • For your References section:

    Genetic modification of primary human B cells to model high-grade lymphoma. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x. 10.1038/s41467-019-12494-x PubMed 31586074
Related items:
Commonly requested with: