Skip to main content
Addgene

MSCV-BCL2
(Plasmid #163611)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163611 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MSCV_IRES_huDC2
  • Backbone size w/o insert (bp) 6574
  • Total vector size (bp) 7304
  • Modifications to backbone
    BCL2 was cloned into MSCV_IRES_huDC2 using Gibson Assembly
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BCL2
  • Alt name
    B-Cell CLL/Lymphoma 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    722
  • GenBank ID
    NM_000633
  • Entrez Gene
    BCL2 (a.k.a. Bcl-2, PPP1R50)
  • Promoter LTR

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The huCD2 portion of the MSCV_IRES_huDC2 backbone was added by Dr Martin Turner, Babraham Institute, Cambridge by modification of Addgene plasmid # 27490.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-BCL2 was a gift from Daniel Hodson (Addgene plasmid # 163611 ; http://n2t.net/addgene:163611 ; RRID:Addgene_163611)

  • For your References section:

    Genetic modification of primary human B cells to model high-grade lymphoma. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x. 10.1038/s41467-019-12494-x PubMed 31586074
Related items:
Commonly requested with: