Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

N-GFP-Dcp2
(Plasmid #163585)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163585 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRP1903
  • Backbone size w/o insert (bp) 5827
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dcp2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4174
  • Entrez Gene
    DCP2 (a.k.a. YNL118C, PSU1)
  • Promoter DCP2 promoter
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer See comments
  • 3′ sequencing primer Dcp2-seq3: CCACATTGATAAGGGTCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    received from Roy Parker's lab at University of Colorado, Boulder

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N-GFP-Dcp2 was a gift from Michael Rosen (Addgene plasmid # 163585 ; http://n2t.net/addgene:163585 ; RRID:Addgene_163585)
  • For your References section:

    A quantitative inventory of yeast P body proteins reveals principles of composition and specificity. Xing W, Muhlrad D, Parker R, Rosen MK. Elife. 2020 Jun 19;9. pii: 56525. doi: 10.7554/eLife.56525. 10.7554/eLife.56525 PubMed 32553117