pWZL Hygro-NMYC TRF2 deltaB deltaM
(Plasmid #16355)

• Depositing Lab: Titia de Lange
• Publication: Smogorzewska et al EMBO J. 2002 Aug 15. 21(16):4338-48.

Backbone

• Vector backbone: pWZL Hygro NMYC
• Backbone size w/o insert (bp): 5900
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTRF2
• Alt name: human TTAGGG repeat binding factor 2
• Alt name: 2435
• Species: H. sapiens (human)
• Insert Size (bp): 1227
• Mutation: Deleted Basic Domain (aa1-44) and Myb Domain (aa454-500)
• Entrez Gene: TERF2 (a.k.a. TRBF2, TRF2)
• Tag / Fusion Protein:
  • Myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTTTGTACACCCTAAGCCT
• 3′ sequencing primer: AATGCTCGTCAAGAAGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the best GenBank reference sequences for the TRF2 insert in the plasmid appear to be NM_005652.3 (nucleotide) and NP_005643.1 (protein). When compared to NP_005643.1, there is an apparent deletion of A434; however, other reference sequences for TRF2 are also lacking this amino acid.