-
PurposeExpresses both eGFP and chicken ovalbumin in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneeGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5973
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced-GFP-chicken ovalbumin tandem
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)1161
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer CTTCTTCAAGTCCGCCATGCCCGAAGGC
- 3′ sequencing primer TTATCTAGATCCGGTGGATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by ananda Mookerjee and Thomas Weber
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP-ova-C1 was a gift from Thomas Weber (Addgene plasmid # 163524 ; http://n2t.net/addgene:163524 ; RRID:Addgene_163524)